Variable Number Tandem Repeat DNA
A Tandem repeat is defined as the repeated end-to-end duplication of a core DNA sequence at a defined locus (Webster). Because of their variation between individuals, these DNA segments are useful for identifying individuals for such purposes as linking a suspect to a crime scene. These are the famed “DNA fingerprints“.
The term “tandem“ is often used to describe systems in which two parts are linked together, such as “tandem bicycle“ (a bicycle built for two), “tandem jump“ (a parachute jump in which student and instructor are tied together in the same harness), “tandem carriage“ (a carriage drawn by two horses harnessed together), etc. Hence, a “tandem repeat“ is DNA consisting of short, repeated base pair sequences “harnessed“ together. (example: gatagatagatagatagata is a tandem repeat consisting of five repeats of tandem “GA“ and “TA“)
Tandem repeat DNA sequences are also called “satellite DNA.“ There are three main types:
A satellite is a highly repetitive DNA sequence with each repeated sequence ranging from a thousand to several thousand base pairs. The entire satellite can be up to 100 million base pairs long, and tend to occur in regions of heterochromatin (tightly wound regions of DNA that are usually not very actively transcribed; found near centromeres and telomeres, among other places.) !). Satellites are abundant on the Y chromosome, which makes a handy tool for those studying paternal genetic transmission in mammals.
A minisatellite is an array of tandem repeats, with each repeat ranging from nine to 100 base pairs (but most commonly around 15 base pairs). The entire array is usually 500 to 30,000 base pairs long. These are most commonly found in euchromatin regions of the chromosome.
A microsatellite is an array of very short repeats (2-6 base pairs each), with the entire array ranging from 10,000 to 100,000 base pairs in length. They have so far been found in the euchromatin regtions of vertebrate, insect and plant chromosomes. The number of repeats varies among individuals in a population, making microsatellites particularly useful to the population geneticist.
Microsatellites...
have many loci each
have a high rate of mutation (10-3 - 10-4 mutations/site/generation, as opposed to 10-8 - 10-9 mutations/site/generation as in single nucleotide polymorphisms (SNPs)
found throughout the genome in
introns
exons
regulatory regions
nonfunctional DNA sequences
more rarely, in coding sequences (in trinucleotide repeat form)
Microsatellites are screened from a genetic library, and the data stored in a computer by a Bioinformatics specialist. They are then part of a database of readily accessible, species-specific microsatellites that can be used to sequence and compare across genomes or within a species.
#geneticCode #rRNA #eukaryotes #chromatid #proteins #mitosis #Morphogenesis #GeneStructure #ChromosomeArm #prokaryotes #TumorCells #GeneticsExamQuestionsSolutions #geneExpression #Isochromosome #Anaphase #DaughterCells #viruses #SisterChromatid #chromosome #Cancer #metaphase #RnaSplicing #genotype #Iherb #tRNA #centromeres #genes #phenotype #TurnerSyndrome #transcription #NikolaysGeneticsLessons #VariableNumberTandemRepeat #DNASequence #DNASegments #telomeres
11 views
511
125
4 months ago 05:31:30 2
Python Tutorial for Beginners - Learn Python in 5 Hours [FULL COURSE]
4 months ago 00:31:25 1
Sonic Adventure DX (TAS) - Sonic’s Story in 24:
7 months ago 00:00:10 1
На этом уроке я не жду перемену! 😁🎸 #электрогитара #гитарист #гитара
7 months ago 00:00:21 1
Harness the power of compressed air to optimize your manufacturing processes.
7 months ago 00:00:33 1
Stay ahead of the competition with our advanced compressed air technology.
7 months ago 00:00:35 1
Empower your operations with our high-performance compressed air solutions.
7 months ago 00:00:37 1
Experience the efficiency and reliability of our state-of-the-art air compressors.
7 months ago 12:00:00 1
Java Full Course for free ☕
7 months ago 00:25:23 1
Дома лучше//Борис Долинин: я готов к переменам
7 months ago 00:00:16 1
Used Flexicon 2-Ton “Bulk-Out“ Portable Bulk Bag Discharger w/Conveyor BFF-S-X
7 months ago 00:04:07 1
here is the Nanxiang air compressor factory
7 months ago 00:00:30 1
Trust in our expertise to deliver the perfect compressed air solution for your needs.
7 months ago 00:00:30 1
Maximize your output with our energy-efficient and environmentally friendly air compressors.
7 months ago 00:00:27 1
Discover the versatility of compressed air for a wide range of applications.
7 months ago 00:00:27 1
here is nanxiang air compressor factory #aircompressorsupplier #aircompressormachine
7 months ago 00:07:45 1
🚩 Задание 14 ЕГЭ по информатике 2024 первая и вторая задачи
7 months ago 00:00:43 1
screw air compressor / oil free air compressor / air compressor factory /Nanxiang air compressor
7 months ago 00:00:33 1
here is the Nanxiang air compressor factory/screw air compressor /oil free air compressor
7 months ago 00:14:41 1
Что хорошего вас ждёт?? 🤩🏆 Расклад таро «Я ГОТОВА К ПЕРЕМЕНАМ»
7 months ago 00:56:18 3
Pre-RF Pulse IV Measurements for Enhanced Transistor Compact Modeling Work
8 months ago 00:01:04 1
Mascara Barb Fish at Planet Earth Aquarium Mysore
8 months ago 00:00:26 1
Unlock new levels of efficiency and cost savings with our innovative air compressor solutions.
8 months ago 00:08:23 1
John Cage - Imaginary Landscape No. 1 (1939)
8 months ago 00:00:27 1
Unleash the power of compressed air for limitless possibilities.