First Ever Video of Silkhenge Spider Birth

Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made? For any licensing requests please contact licensing@ Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below: Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAA