Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made?
For any licensing requests please contact licensing@
Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below:
Web tower-COI-5P
GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAA
10 views
3315
883
4 weeks ago 00:03:02 1
I Have No Change - Announcement Teaser
4 weeks ago 00:01:54 1
I Put WOLVERINE’S MASK in DEADPOOL & WOLVERINE Fight Scene
1 month ago 00:03:16 1
Pope Francis Declares Lucifer As God
1 month ago 00:45:17 1
I Pledged $5200 to The Binding of Isaac Kickstarter and this is what I got...
1 month ago 00:03:45 8
New Year’s Greetings 2025 | Monster Hunter Wilds Open Beta Test 2 Announcement
1 month ago 01:44:33 1
Book launch — Trotsky(ism): Tool of Imperialism
1 month ago 00:31:49 1
SUPER-HERO-BOWL Reaction! BEST VIDEO EVER!?
1 month ago 01:37:08 125
Michale Graves Performs Misfits Classics: Full Concert in Israel with Exclusive Interview 16/07/2024
1 month ago 00:01:16 1
Andor Season 2 - Teaser Trailer | Star Wars & Disney+ | Diego Luna & Ben Mendelsohn (2025)
2 months ago 00:56:07 1
Geoengineering Watch Global Alert News, December 28, 2024, # 490 ( Dane Wigington )
2 months ago 00:01:33 1
Kyoryu - Official Gameplay Trailer
2 months ago 00:03:41 1
ANTEDILUVIAN. Animated Short Film
2 months ago 00:16:04 1
How Immigrants Shape(d) the United States | Nalini Krishnankutty | TEDxPSU
2 months ago 01:14:45 1
The closest and most intense chess match ever (Odds match against Alyssa Zhu)
3 months ago 01:06:40 1
Global Rhythms Unleashed: Beatweezy Live on The Rhythm Connect with Julyka 🌍
3 months ago 00:02:31 1
A Minecraft Movie | Official Trailer
3 months ago 00:00:37 1
I AM KIRA || Death Note
3 months ago 00:04:14 1
The Hunter - Bloodborne (4K UHD 2024)
3 months ago 00:04:35 2
My Girl OST - Sang-eo-reul Sa-rang-han In-eo (Male Version)
3 months ago 02:50:34 1
Sam & Colby’s HAUNTED School: Our Journey To America’s Scariest Schools
3 months ago 00:00:51 4
Ruslan Salei Game 3 OT goal vs New Jersey Devils 2003
3 months ago 00:02:56 1
Robert Simmon “Mr. Blue Marble“
3 months ago 00:29:15 1
I 3D-Printed a Glock to See How Far Homemade Guns Have Come
4 months ago 00:03:04 3
Creedence Clearwater Revival - Have You Ever Seen The Rain (Official)